Introduction
Odontogenesis, the tooth development including odontogenic cell differentiation, proliferation, movement and death etc. is tightly regulated [1,2]. Tooth development begins with odontogenic epithelium and neural crest-derived ectomesenchymal cells, which further develop into the enamel organ and the dental papilla, respectively. These two kinds of tissues interact reciprocally to differentiate into ameloblasts and odontoblasts for amelogenesis and dentinogenesis, respectively. Tooth development under light microscopy is divided into the bud, cap and bell stages depending on the shape of the enamel organ, proceeding to crown and root formation stages.
Amelogenesis begins at the late bell stage, lagging behind dentin formation. Amelogenesis is a highly orchestrated extracellular processes that regulate the nuclear growth and organization of hydroxyapatite crystals [3,4]. Thus, amelogenesis has been suggested to be strictly regulated by matrix proteins that are secreted into a extracellular space where they may function for hydroxyapatite apatite crystal formation and arrangement. However, its mechanism is largely unknown. Currently, three major matrix proteins are known to be involved in enamel formation: amelogenin, ameloblastin and enamelin [5]. However, the sequential expression, localization and functional role of these molecules are not certain and still contentious. Determination in function of these three molecules is crucial to understand amelogenesis in normal and pathological tooth development.
Current understanding is that ameloblasts produce enamel matrix proteins. Amelogenin constitutes approximately 90% of newly secreted enamel matrix. Ameloblastin is a sheath protein along with amelin and sheathlin. In the present study, amelogenin and ameloblastin were differentially expressed between the cap stage and the root stage. The differential and sequential expression, localizations and the functional interrelationship of the three major proteins were investigated under the postulation that these molecules may provide an enamel with the hardest nature in creatures.
Materials and Methods
Animals and tooth germs
Sprague-Dawley rats at postnatal days 1, 4, 7, 10 and 14 were used. Preliminary histological studies demonstrated that the maxillary 2nd molars were at the root stage, whereas the maxillary 3rd molars were at the cap stage in tooth development at postnatal day 10. Furthermore, the maxillary 2nd molars were at the late bell, crown and root stages at postnatal days 4, 7 and 10 respectively. After the gingivae and overlaying alveolar bone were carefully removed, molar germs were taken out.
Administration of alendronate
Alendronate (1 mg/kg) was every other day injected into subcutaneous tissue in the posterior neck of rat pups at postnatal day 1 for 4, 7 and 10 days. For the control group, saline was administered.
Microscopic observation
Portions of the maxillae were isolated and fixed in 4% paraformaldehyde solution overnight. After decalcified with ethylene diamine tetra-acetic acid (pH 7.4), tissues were embedded in paraffin. Sagittal sections were cut 5 μm thick for hematoxylin-eosin and immunofluorescence staining.
Identification of genes
Total RNA was extracted from the extracted tooth germs using Trizol® Reagent (Gibco BRL, Grand Island, MD, USA). GeneFishingTM DEG kit 101 (Seegene, Del Mar, CA, USA) was used for differential display PCR (DD-PCR). Products were electrophoresed on 1.5% agarose gel and stained with ethidium bromide. Differentially expressed bands were excised from the gel and eluted using QIAquick gel extraction kit (Qiagen Inc., Valencia, CA, USA). The eluted DNA was ligated with pGEM-T® Easy Vector using T4 DNA ligase (Promega, Madison, WI, USA) at 16℃ overnight. The positive inserts were checked on the agarose gel by DNA preparation using E.Z.N.A plasmid miniprep kit (Omega Bio-tek Inc, Doraville, GA, USA). Sequencing of positive inserts using T7 promoter primer demonstrated that they were parts of amelogenin and ameloblastin genes respectively.
PCR
For reverse transcription, AccPowerⓇ RT PreMix (Bioneer, Daejeon, Korea) was used. For PCR reaction, AccPowerⓇ PCR PreMix (Bioneer) were used. The primer sequences for amelogenin were 5' CAGCCGTATCCTTCCTATGG 3' for the forward and 5' CTTCTTCCCGCTTGGTCTTG 3' for the reverse, generating an expected product of 442 bp. The primer sequences for ameloblastin were 5' TACCAATAATGGATTTT GCC 3' for the forward and 5' AGTAAAGTCTCCTCCCTTGG 3' for the reverse, generating an expected product of 299 bp. The primer sequences for enamelin (GenBank accession no. XM-001073517) were 5' CACACACAGTGAAGTCCAAG 3' for the forward and 5' GTCCTGTTGACTGGTGTCTT 3' for the reverse, generating an expected product of 298 bp. The housekeeping gene GAPDH (GenBank accession no. AF 106860) was also amplified using primer sequence of 5' CCATGGAGAAGG CTGGGG 3' for the forward and 5' CAAAGTTGTCATGGATGACC 3' for the reverse, generating an expected product of 195 bp. PCR products were resolved on a 1.2% agarose gel and visualized using ethidium bromide.
Western blotting
Protein extraction was performed using Ready-prep protein extraction kit (Bio-RAD, Hercules, CA, USA). and transferred to Protran nitrocellulose membrane (Whatman GmbH, Dassel, Germany). The membrane was then incubated with the purified goat polyclonal antibody for ameloblastin, goat polyclonal antibody for enamelin, rabbit polyclonal antibody for amelogenin (Santa Cruz Biotech Inc., Delaware, CA, USA) and mouse monoclonal antibody for β-actin (Sigma-Aldrich Co., ST Louis, MO, USA). The membrane was then incubated with anti-goat IgG horseradish peroxidase-conjugated secondary antibody (Santa Cruz Biotech Inc.), anti-rabbit IgG horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology, Beverly, MA, USA) and anti-mouse IgG horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology). Bound antibodies were visualized with Lumiglo reagent (Cell signalling Technology).
Immunofluorescence stain
Normal serum was substituted with primary antibodies for the negative control. Immunofluorescence staining was performed using TSATM Kit (Invitrogen, Carlsbad, CA, USA). Sections were reacted with the primary antibodies overnight, and subsequently in HRP-conjugated secondary antibody. Finally, they were then incubated in Tyramide working solution. Reactants were visualized and photographed using a LSM confocal microscope (Carl Zeiss, Standort Gȍttingen-Vertrieb, Germany).
Results
Histological findings of tooth germs
The maxillary 3rd molar tooth germs at postnatal day 10 were at the cap stage. Under the enamel organ, ectomesenchymal cells were closely aggregated to form the dental papilla and sac. The upper 2nd molar tooth germs were at the root stage at postnatal day 10, which was characterized by the epithelial diaphragm for root formation. Ameloblasts at the cuspal region became reduced enamel epithelia after the completion of enamel formation (Fig. 1). The upper 2nd molars were at the early bell, the crown and the root stages at postnatal days 4, 7 and 10, respectively.
DD-PCR and identification of genes
Comparing the 3rd molar with the 2nd molar, one differentially expressed band of approximate 500 bp in size was detected in the 2nd molar only by using ACP No 34. This band sequenced as amelogenin mRNA. The other differentially expressed band was approximately 600 bp in size and detected by using ACP No 41. This band was identified as ameloblastin mRNA.
mRNA expression at tooth development
RT-PCR was performed using specific primers for amelogenin, ameloblastin and enamelin genes to compare their expression level between in the upper 3rd molars at the cap stage and in the 2nd molars at root stage. The expression level of all these genes was much higher in the 2nd molars than in the 3rd molars (Fig. 2a). The mRNA expressions of amelogenin, ameloblastin and enamelin genes in the upper 2nd molars at postnatal days 4 (early bell stage), 7 (crown stage), and 10 (root stage) were also analysed to elucidate their putative roles for tooth development. They were all upregulated at the crown and root stages (Fig. 2b).
To elucidate secretory mechanism of enamel matrix proteins, alendronate, which has been known to have inhibitory function for tyrosine phosphatase, was administered in rat pups for postnatal days 4, 7 and 10. The mRNA expressions of amelogenin and ameloblastin at the 2nd molars were much decreased by the bisphosphonate treatment for 7 and 10 days. However, enamelin mRNA expression was not changed by the treatment for the whole periods (Fig. 3).
Analysis of protein expression at tooth development
Western blotting revealed amelogenin expression in the 2nd molars as many processed forms ranging from approximately 5-45 kDa in size. Ameloblastin was expressed as approximate 62-72 kDa in size in both the 3rd and 2nd molars, where the expression was more than in the 2nd molars. The expression of ameloblastin was earlier than those of enamel and amelogenin. Enamelin expression was represented in the 2nd molars only as two processed forms from approximately 65-89 in size (Fig. 4a). To compare 3 kinds of enamel matrix gene expressions during development, protein levels of the 2nd molars at the early bell, the crown and the root stages, were compared. The expressions of both amelogenin and enamelin began at the crown stage and increased in a time dependent manner. In contrast, the expression of ameloblastin began at the early bell stage and maintained its expression to the root stage (Fig. 4b).
Immnofluorescence Findings
At postnatal day 7, the 2nd molar showed strong reactivity against amelogenin at tall columnar preameloblasts or ameloblasts. Notably, amelogenin expression was also occasionally seen in preodontoblasts or odontoblasts (Fig. 5a). At postnatal day 10, strong reactivity for amelogenin was observed in ameloblasts at secretary stage in the 2nd molar. The expression, however, was not continuous along the entire maturing enamel, reflecting that ameloblasts were different in function. The reactivity was negative in the dentin matrix. However, the cap staged 3rd molar was negative in reaction (Fig. 5b). At postnatal day 14, the 1st molar showed maturing enamel matrix, most part of which were eliminated during demineralization for tissue preparation and represented as horneycomb appearance. The 2nd molar also was undergoing maturation of the enamel matrix which still had strong immunoreactivity against amelogenin. However, any reactivity could not be seen in reduced enamel epithelia in both molars (Fig. 5c). Amelogenin was also demonstrated in polyheadral cells of root sheath in hair follicles, which have been known to show the similar developmental features to tooth development (Fig. 5d).
Immunoreactivity against ameloblastin was seen at ameloblasts and the enamel at the root staged 2nd molar. Strong reactivity also are seen in the alveolar bone. The 3rd molar germ and odontoblasts also show immunoreativity, weak though (Fig. 5e). Notably, strong reactivity was mainly seen at Tomes processes, apical projections of ameloblasts (Fig. 5f).
Immunoreactivity against enamelin was seen at ameloblasts and the enamel. Notably, strong reactivity was mainly seen at the apical region of ameloblasts (Fig. 5g, h). The reactivity in the enamel was strong at the periphery of the enamel rods (Fig. 5i). The negative control omitting the primary antibody was totally negative in reaction (Fig. 5j).
Discussion
It has been accepted that different level of gene expression underlies for different morphology of the tooth. Recent studies have been attempted to identify the signal molecules involved in tooth development and rapidly widened the knowledge of the signalling networks [6]. DD-PCR revealed many bands showing different level of expression. Among these, amelogenin and ameloblastin were true positive. Currently, knowledge concerning the mechanism of action in mineralization of enamel and composition and maturational change of enamel matrix proteins is lacking. Current understanding is that ameloblasts produce two kinds of matrix proteins; amelogenin and non-amelogenin. Ameolgenin constitutes approximately 90% of secreted enamel proteins and is relatively homogeneous. Ameloblastin and enamelin are classified as non-amelogenin proteins. The role of these proteins in enamel mineralization has been still contentious.
The expression of amelogenin in ameloblasts has been well known [7,8], its biological function of amelogenin is not clear yet, however. This molecule may self-assemble into supramolecular nanospheres, controlling the ionic activity of calcium and the orientation of the developing hydroxyapatite crystals [9,10] and be involved in cementogenesis [11] and cell-adhesive function for periodontal regeneration [12]. In the present study, amelogenin protein was exclusively expressed in the hard tissue forming stage during tooth development and distributed uniformly in the immature enamel matrix. However, amelogenin was also expressed in preameloblasts as well as ameloblasts.
The present study also detected amelogenin in preodontoblasts and odontoblasts. Moreover, immunoreactivity against this was incidentally found in hair follicles, which have no relation to mineralization and develop from reciprocal interaction between skin epithelium and mesenchyme as seen in tooth development [13,14]. The early expression of amelogenin by ameloblasts/preameloblasts and odontoblasts/preodontoblasts suggested that amelogenin may play a role in histodifferentiation by a certain way such as reciprocal epithelial-mesenchymal signalling, besides the suggested role of formation of hydroxyapaptite crystals. This suggestion was supported by the report [15] that amelogenin could be signalling molecule, the report that amelogenin is a negative regulator of osteoclastogenesis via downregulation of signalling molecules in osteoblasts [16] and the report that amelogenin in vivo and in vitro affected proliferation and differentiation of pulpal cells [17]. The expression in odontoblasts were however, discontinuous, suggesting that it may play a different role from ameloblasts. This localization of amelogenin in the dentin and odontoblasts supported the suggestion that odontoblasts synthesize and secrete amelogenin protein during human tooth development that enhance pulp cell proliferation [18]. However, further studies are needed for the role of amelogenin in the dentin.
Ameloblastin, also known as amelin or sheathrin, was also expressed in transcriptional and translational levels. Soon after this protein secretion, its C-terminal fragments are rapidly degraded, whereas N-terminal fragments retained in rod sheath [19]. In the present study, N-terminal fragment was localized in Tomes processes, the distal end of ameloblasts as well as in the enamel matrix. Ameloblastin expression was detected as early as in the cap staged 3rd molars at postnatal day 10 by the Western blot. This earlier expression of ameloblastin than amelogenin was in coincident with the previous report [7]. Differences in the expression time and expression pattern from amelogenin suggested that these two matrix proteins may have different functions during amelogenesis. These are supported the report by Uchida et al. [19] that ameloblastin may serve an early function to adhere ameloblasts or preameloblasts to enamel matrix, and the report by Fukumoto et al. [20] that ameloblastin may regulate proliferation of ameloblasts since ameloblasts in ameloblastin-deficient mice continue to proliferate. In the present study, ameloblastin was also strongly expressed in the alveolar bone, which was recently reported also by Spahr et al. [21], suggesting that this protein may play a role more than enamel formation.
Enamelin was exclusively expressed in the 2nd molars at postnatal day 10. Its localization was mainly detected in the apical region of ameloblasts and enamel matrix as Lv et al.[22] reported. The reactivity in the enamel against enamelin were strong at the periphery of the enamel rods in the root staged 2nd molar at postnatal day 14, at which ameloblasts became reduced enamel epithelium, completed enamel formation and underwent maturation. The expression of this molecule was not affected by the treatment of alendronate which inhibits activity of protein-tyrosine phosphatase in cell differentiation [23]. In contrast, the expression of amelogenin and ameloblastin were greatly reduced by the treatment for 7 and 10 days. These results suggested that enamelin may be expressed by a different mechanism from amelogenin and ameloblastin. Further study for combined action of these molecules is a need [24].
