Introduction
Microglia are immune cells that exist in the central nervous system (CNS). They serve an important role in maintaining homeostasis and responding to injury and disease. Their roles in immunological protection, maintenance, and repair demonstrate their relevance in both normal brain function and illness. Microglial malfunction is associated with several pathological conditions. Defective microglial response can be the critical factor for tau pathology dissemination and dementia progression [1]. Microglial activation starts early and lasts throughout Parkinson’s disease (PD) [2]. Microglia possess a high level of phagocytic capacity and can inhibit PD progression through uptake and clearance of α-syn. However, when microglia become reactive and proliferate abnormally, which can be triggered by pathological α-synuclein, they release toxic proinflammatory cytokines, resulting in neuronal damage and PD progression [3].
Extracellular traps (ETs) are web-like structures composed of DNA, histones, and antibacterial proteins that are released by immune cells to capture and kill pathogens. ETs, which function in various situations such as immune protection, inflammatory and autoimmune diseases and cancer, have been known to be mainly released by innate immune cells of the peripheral nervous system, such as macrophages and neutrophils [4]. However, recently, it has been discovered that microglia can also release ETs in response to specific stimuli such as pathogens or inflammatory signals [5]. These microglial ETs, also known as microglial traps, perform similar functions to ETs produced by other immune cells, including capturing and killing pathogens and protecting the CNS from infection. Although there are reports that cytosolic reactive oxygen species (ROS) and NADPH oxidase (NOX) are involved in ET formation, the detailed mechanisms related to ET formation and function in microglia have not yet been sufficiently studied.
Secretagogin (Scgn) is a calcium-binding protein enriched in multiple endocrine cells [6]. Although Scgn is known to be highly expressed in pancreatic β-cells, where it regulates insulin secretion, it is also detected in various parts of the brain, including the hippocampus and cerebellum [7]. In the brain, Scgn plays an important role in neurotransmitter release, and Scgn deficiency might be associated with several neurological disorders, including schizophrenia, autism, and neurodegeneration [8,9]. Although Scgn expression data and functional studies in neurons are constantly being collected, little study has been done in glial cells to date. In this study, we investigated the previously unidentified roles of Scgn in microglial physiology.
Materials and Methods
1. Plasmid construction
The lentiCRISPR v2 plasmid (cat. no. 52961; Addgene Inc.), a gift from Dr. Feng Zhang [10], was digested with BsmBI (New England Biolabs) followed by dephosphorylation and gel purification. For genetic silencing of Scgn, a pair of oligos (5′‑CACCGGATCTGGCAGCGCTTCGACA‑3′ and 5′‑AAACTGTCGAAGCGCTGCCAGATCC‑3′; Macrogen) were phosphorylated, annealed, and ligated into the digested lentiCRISPR v2 plasmid, which was called LC‑Scgn.
2. Cell culture and generation of secretagogindeficient cells
BV-2 murine microglial cells were maintained in Dulbecco’ s modified Eagle’s medium (DMEM; Cytiva) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific). Cells were incubated in a humidified atmosphere containing 5% CO2 at 37℃.
To generate Scgn‑deficient cells, the 1 μg of LC‑Scgn construct was transfected into BV-2 cells by using Lipofectamine 3000 (Thermo Fisher Scientific), according to the manufacturer’ s instructions. BV‑2 cells transfected with green fluorescent protein‑targeting plasmid were used as control cells. After 2 days of transfection, the cells were selected with 2 μg/mL puromycin. Puromycin-resistant control and Scgn‑deficient cells were maintained in DMEM supplemented with 10% fetal bovine serum, 1% penicillin-streptomycin and 2 μg/mL puromycin.
3. Immunofluorescence
At 24 hours after phosphate-buffered saline (PBS, Cytiva) or 1 μg/mL lipopolysaccharide (LPS, Sigma-Aldrich) treatment, growth media was removed and cells were washed with PBS. Fixation and permeabilization were performed with 4% paraformaldehyde and 0.2% Triton X-100/PBS (Sigma-Aldrich), respectively, for 15 minutes each at room temperature. After blocking with 2% bovine serum albumin/PBS, the cells were subjected to immunofluorescence staining with a primary antibody against myeloperoxidase (MPO) (1:100; Santa Cruz Biotechnology) overnight at 4℃. The next day, cells were washed with PBS and incubated with Alexa Fluor®-conjugated goat anti-mouse IgG (Abcam) for 30 minutes at room temperature. For nuclear staining, the cells were incubated with Hoechst 33342 dye (Thermo Fisher Scientific) for 5 minutes. Fluorescence signals were visualized with an EVOS FL Auto Imaging System (Thermo Fisher Scientific).
4. Protein preparation and immunoblot analysis
For immunoblotting, cells were disrupted directly with laemmli buffer, followed by sonication and heat-denaturation. Immunoblot analyses were performed with anti-phospho c-Jun N-terminal kinase (JNK), anti-Scgn (Cell Signaling Technology), anti-p62 (Abcam), anti-LC3B (Novus Biologicals), and anti-β actin (Sigma-Aldrich). After membranes were incubated with secondary anti‑rabbit (Abcam) and anti‑mouse (Bethyl Laboratories) antibodies that were horseradish peroxidase conjugated, immunoreactive signals were detected using the D‑PlusTM ECL Femto system (Dongin Biotech) and Fusion Solo S chemiluminescence imaging system (Vilber).
5. Reactive oxygen species detection
Intracellular ROS levels were determined using the fluorogenic CellROX® reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. Mitochondrial superoxide levels were determined using the fluorogenic MitoSOX® reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions. CellROX and MitoSOX reagents were applied to cultivated cells at final concentrations of 5 μM and 1 μM, respectively, for 30 minutes. Nuclear DAPI staining was conducted with NucBlue Live ReadyProbes Reagent (Thermo Fisher Scientific) for 5 minutes. Fluorescent microscopic images were acquired using the EVOS FL Auto Imaging System (Thermo Fisher Scientific).
6. NADP+/NADPH measurement
At 24 hours after PBS or 1 μg/mL LPS treatment, growth media was removed and cells were washed with PBS. NADP+ and NADPH were assayed in triplicate with NADP/NADPH Glo kit (Promega), following manufacturer’s instructions.
7. Detection of the extracellular trap
ET formation was detected by SYTOXTM green staining of extracellular DNA. SYTOXTM green (1:1,000) was applied to cultivated cells for 10 minutes without fixation. Fluorescent microscopic images were acquired using the EVOS FL Auto Imaging System.
8. Statistical analysis
Statistical analysis was performed using Prism 8.4.3 (GraphPad). The one-way ANOVA was used for experiments comparing difference of data unless noted. All results are expressed as mean±standard error of the mean. Differences were considered significant when p ＜ 0.05, p ＜ 0.01, p ＜ 0.001, p ＜ 0.0001.
Results
1. Secretagogin is expressed in microglia
While Scgn expression has been validated in neuronal cell subtypes, it has yet to be proven in microglia. To obtain clues about Scgn expression in microglia, we analyzed the results of two independent studies that performed single-cell sequencing with brain samples [11,12]. By utilizing sing cell portal (https://singlecell.broadinstitute.org/single_cell), we checked cell type specific expression of Scgn within the brain. As expected, it was shown that Scgn was highly expressed in neuronal cells. On the other hand, the two studies gave different results regarding the expression of Scgn in some cell types such as astrocytes, endothelial cells, oligodendrocyte precursor cells, and pericytes. However, both studies showed that Scgn seemed to be expressed in microglia (Fig. 1A and 1B). To investigate the functional significance of Scgn in microglia physiologies, we generated Scgn-deficient BV-2 microglia cells using Crispr/Cas9 (LC‑Scgn; Fig. 1C) and experimentally verified the expression of Scgn in microglia through immunoblotting.
2. Extracellular traps are formed by secretagogin deficiency without external stimuli
To identify the biological function of Scgn in microglia, we performed gene set enrichment analysis with a list of genes that showed a correlation in expression level with the Scgn by using the LinkedOmics (http://www.linkedomics.org). Interestingly, neutrophil mediated immunity and granulocyte activation displayed negative normalized enrichment score, suggesting that Scgn may inverse correlation with these biological functions (Fig. 2A and 2B). Based on the fact that microglia can release ETs like neutrophil granulocytes upon activation, we monitored ETs formation under Scgn silencing. Apparently, some cells lacking Scgn emitted ETs (Fig. 2C), which was independent of the presence or absence of LPS.
3. Secretagogin silencing does not increase oxidative stress in BV-2 microglia
Previously, it was reported that ROS, including superoxide, can induce ETs formation in neutrophil [13]. To assess the effect of Scgn depletion on intracellular oxidative stress, ROS levels were monitored by CellROX staining in control and Scgn‑deficient BV-2 cells. As a result, Scgn silencing had no dramatic effect on the amount of oxidative stress under unstimulated settings. Rather, the lack of the Scgn reduced oxidative stress when LPS was administered (Fig. 3A and 3C). Considering the contribution of mitochondrial oxidative stress on neutrophil ETs formation [14], mitochondrial superoxide levels were determined by MitoSOX staining. Our results additionally showed that Scgn deficiency did not increase ROS levels in mitochondria (Fig. 3B and 3D). Together, these results suggest that Scgn depletion-induced ETs formation is not mediated by excessive oxidative stress.
4. JNK-MPO pathway and autophagy may contribute to extracellular traps formation in secretagogindeficient microglia
In neutrophil antimicrobial responses, MPO is required for ETs formation [15]. Microglia are reported to express MPO [16] and the expression pattern is particularly evident in patients with neurodegenerative diseases [17]. Interestingly, our findings revealed that MPO level is significantly upregulated in Scgn- deficient BV-2 cells, regardless of LPS treatment (Fig. 4A and 4B). Despite reports that LPS induces MPO levels in some cell types [18], no increase in MPO expression was detected under our experimental conditions.
ETs formation can be activated by both NADPH-dependent and independent processes [19]. LPS upregulates G6PDH expression and activity, leading to enhancements in the pentose phosphate pathway activity and NADPH production [20]. Electrons of cytoplasmic NADPH are transferred to extracellular oxygen via NOX proteins, producing ROS [21]. Our findings indicated that LPS treatment reduced the NADP+/NADPH ratio, which may explain the increase in NADPH (Fig. 4C). In addition, we also monitored dramatic downregulation of the NADP+/NADPH ratio under Scgn silencing. However, this result did not lead to ROS overproduction in our experimental conditions.
It was previously proven that JNK activation induces MPO expression and turns on ETs casting [22,23]. Clearly, phospho JNK level was elevated in Scgn-depleted BV-2 cells (Fig. 4D). Furthermore, consistent with earlier report indicating autophagy is linked to ETs production [24], Scgn-deficient cells displayed activated autophagy signature (Fig. 4D). Together, our data collectively suggest that Scgn deficiency-induced ETs formation may be mediated by JNK-MPO pathway and autophagy.
Discussion
Since the discovery of ETs in neutrophils in 2004 [25], there has been extensive investigation into the components and functions of ETs. ETs are mostly composed of DNA, histones, and antimicrobial granules, which, by binding to foreign substances, not only impede the spread and kill microorganisms but also promote phagocytosis. The process of forming ETs is sometimes accompanied by neutrophil cell death, which is called NETosis. While ETs play beneficial roles in the innate immune response, but when excessive, they can cause tissue damage [26].
Scgn is a calcium-sensor protein and has been known to play an important role in glucose metabolism and the release of various peptide hormones such as insulin [27]. In the brain, Scgn is mainly expressed in nerve cells and is known to regulate neuronal plasticity and synaptic function [28]. However, the expression of Scgn has rarely been examined in immune cells such as microglia, and its function is largely unknown. In this study, we demonstrated that Scgn deficiency can result in the creation of aberrant ETs, and we hypothesized that the JNK-MPO pathway and autophagy activity may be involved.
Release of microglial ETs is associated with a variety of neurological conditions, including nerve injury, tumor microenvironment, and ischemic stroke [26,29]. However, the role of microglial ETs in these conditions is not yet fully understood, and further studies are needed to elucidate its function and potential therapeutic implications.
